<!--QuoteBegin-AvengerX+Mar 14 2005, 02:49 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 02:49 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> that new hyperlink is drawn though... not fossils.... sure anyone with imagination can say " hey this kinda looks like this... which kinda looks like this... which kinda looks like that.." <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Here is the page I got that from: <a href='http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Taxonomy.html' target='_blank'>http://users.rcn.com/jkimball.ma.ultranet/...T/Taxonomy.html</a> I'd love to debate homologous structures and similarities between hox genes and hemoglobins, but my understanding of them isn't great enough to explain them very well. Here's wikipedia on Hox genes: <a href='http://en.wikipedia.org/wiki/Hox_gene_family' target='_blank'>http://en.wikipedia.org/wiki/Hox_gene_family</a> Hox genes are found in all animals, from flies to humans. Hox genes are used to determine which side is up and which side is forward. Animals like humans use the hox genes to make sure that we develop in the correct directions. Insects use the hox genes to create their segments. Starfish only have one set of hox genes, for top and bottom, but not for front and back, which is why they exhibit radial symmetry. Here's some more on this sort of thing: <a href='http://en.wikipedia.org/wiki/Molecular_clock' target='_blank'>http://en.wikipedia.org/wiki/Molecular_clock</a> Here's a choice quote: <!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->the quantity of amino acid differences in hemoglobin between lineages roughly matched the known evolutionary rate of divergence based upon fossil evidence<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> DNA evidence shows that some parts of DNA are almost exactly the same in all forms of life, from bacteria to humans. That's why they can splice genes from some animals into other animals (and the basis for some genetic engineering in GM crops). Other parts of DNA are similiar but different roughly based upon how closely related two forms of life are. Our hemoglobin DNA segments are very close to chimpanzees and gibbons, somewhat close to mice, and pretty far away from flies.
Now, do you have any objections to this, or do you accept that macroevolution is true?
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Only threw perseverance did the snail reach the ark my friend. And right you are the strong survive. So strong monkeys grow up and have baby MONKEYS <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> You're right. Monkeys have baby monkeys.
However, what happens if two groups of the same species of monkey are split apart? Say, because of the separation of continents due to tectonic plates shifting. They'll be in different environments. If one environment is wet and the other is dry, then the monkeys that use their water more efficiently will thrive in the drier environment, while the monkeys that can take advantage of the increased water will thrive in the wetter environment. Eventually, they won't be able to breed together and macroevolution has occured.
Here's a real life example: <a href='http://www.santarosa.edu/lifesciences/ensatina.htm' target='_blank'>http://www.santarosa.edu/lifesciences/ensatina.htm</a>
Salamanders exist in california in a gradient. There is species A that is right next to species B that is right next to species C that is right next to species D and so on. Species A can interbreed with species B and C, but not with species D. Species B and interbreed with A and C and D, but not with E. Etc. Even though the salamanders are connected by land in a continuous path, they still have formed many different species. Strong salamanders group up and have baby salamanders that are slightly different, just enough so that new species can form.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->how come if there's millions of fossils that show missing links there's no living animals that show missing links? I mean why isn't their any monkey/human hybrids running around anymore?<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> Evolution doesn't expect human/monkey hybrids. Think of it like this: You've got a 3rd cousin. You share great great grandparents with this cousin. If you are both descended from the same person, why isn't there a hybrid between you and your cousin? Why isn't there a hybrid with your eyes, her ears, your hair color, etc?
<!--QuoteBegin-AvengerX+Mar 13 2005, 11:57 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 13 2005, 11:57 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> I mean why isn't their any monkey/human hybrids running around anymore? <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Because they either evolved into us, or died out (neanderthals, cro magnus, which both lived during the existance of homo sapiens, but eventually died out).
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->theres only four acids that make up DNA. so its really no wonder everything is somewhat close.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
That doesn't really make sense. I mean, in a computer, there are only two states for a bit: 1 and 0. Yet if you look at all the different things that come from a computer, they can be very, very different.
so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle?
<!--QuoteBegin-Mantrid+Mar 14 2005, 03:11 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (Mantrid @ Mar 14 2005, 03:11 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 13 2005, 11:57 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 13 2005, 11:57 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> I mean why isn't their any monkey/human hybrids running around anymore? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> Because they either evolved into us, or died out (neanderthals, cro magnus, which both lived during the existance of homo sapiens, but eventually died out).
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->theres only four acids that make up DNA. so its really no wonder everything is somewhat close.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
That doesn't really make sense. I mean, in a computer, there are only two states for a bit: 1 and 0. Yet if you look at all the different things that come from a computer, they can be very, very different. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> but computer programs don't all come from the same computer program. they didn't evovlve from one omni program did they.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:06 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:06 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> theres only four acids that make up DNA. so its really no wonder everything is somewhat close. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> I don't think you understand. Here are two sample DNA sequences that I made up out of thin air: <!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1--> AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA AAAGCCCCCCCCAAAATTGGCATTGGCATGCTCGA <!--c2--></td></tr></table><div class='postcolor'><!--ec2--> <!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1--> AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA AAAGCCCCCCCCAAAATTCGCATTGGCATGCTCGA <!--c2--></td></tr></table><div class='postcolor'><!--ec2--> Don't spot the difference? Check after the TT in the second line.
The difference between these two sequences is greater than the difference between human and chimpanzee DNA. Even though there are only 4 acids, if the acids were chosen randomly, there would be about a 1 in 4000000000000000000000000000000000000000000000000000000000000 chance that the 2 DNA sequences would show the same amount of difference as human and chimpanzee DNA. That's only for 100 base pairs. If you did 100 base pairs, it would be exponentially higher than that.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:12 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:12 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> The environment would be something like sub-Saharan Africa.
<!--QuoteBegin-theclam+Mar 14 2005, 03:15 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:15 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:06 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:06 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> theres only four acids that make up DNA. so its really no wonder everything is somewhat close. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> I don't think you understand. Here are two sample DNA sequences that I made up out of thin air: <!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1--> AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA AAAGCCCCCCCCAAAATTGGCATTGGCATGCTCGA <!--c2--></td></tr></table><div class='postcolor'><!--ec2--> <!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1--> AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA AAAGCCCCCCCCAAAATTCGCATTGGCATGCTCGA <!--c2--></td></tr></table><div class='postcolor'><!--ec2--> Don't spot the difference? Check after the TT in the second line.
The difference between these two sequences is greater than the difference between human and chimpanzee DNA. Even though there are only 4 acids, if the acids were chosen randomly, there would be about a 1 in 4000000000000000000000000000000000000000000000000000000000000 chance that the 2 DNA sequences would show the same amount of difference as human and chimpanzee DNA. That's only for 100 base pairs. If you did 100 base pairs, it would be exponentially higher than that. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> so what your saying. is that god used a lot of the same code when he made man as when he made monkeys right?
<!--QuoteBegin-theclam+Mar 14 2005, 03:16 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:16 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:12 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:12 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> The environment would be something like sub-Saharan Africa. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others?
What I'm saying is that if God did create life, the universe and everything, then he did in a way that suggests beyond all reasonable doubt that today's life was created through evolution. Apparently he wants you to think that evolution is true, AvengerX.
<!--QuoteBegin-theclam+Mar 14 2005, 03:18 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:18 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> What I'm saying is that if God did create life, the universe and everything, then he did in a way that suggests beyond all reasonable doubt that today's life was created through evolution. Apparently he wants you to think that evolution is true, AvengerX. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> then he should have written it in the scriptures.
Humans evolve. look at eskimoes.. they've evolved to be short and fat. and it works out for them... but if we leave eskimoes alone long enough, they won't turn into polar bears or gaint human penguins.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:17 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:17 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-theclam+Mar 14 2005, 03:16 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:16 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:12 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:12 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you.
<!--QuoteBegin-theclam+Mar 14 2005, 03:20 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:20 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:17 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:17 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-theclam+Mar 14 2005, 03:16 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:16 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:12 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:12 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> because of crossing over. the DNA messes around a lil bit... I don't remember but I learned about it in biology.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:20 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:20 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-theclam+Mar 14 2005, 03:18 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:18 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> What I'm saying is that if God did create life, the universe and everything, then he did in a way that suggests beyond all reasonable doubt that today's life was created through evolution. Apparently he wants you to think that evolution is true, AvengerX. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> then he should have written it in the scriptures. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Do you actually think that God explicitly tells you everything that he wants you to know? Are you presuming that scriptures tell you every single thing that he wants you to know? That's like a teacher handing you a stack of books and telling you that the stack contains every single thing that you will learn in school and that experience and self-exploration (or scientific exploration in the case of evolution) aren't part of that?
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Humans evolve. look at eskimoes.. they've evolved to be short and fat. and it works out for them... but if we leave eskimoes alone long enough, they won't turn into polar bears or gaint human penguins.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> So? That's a strawman, no one is claiming that they would.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:21 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:21 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-theclam+Mar 14 2005, 03:20 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:20 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:17 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:17 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-theclam+Mar 14 2005, 03:16 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 03:16 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 03:12 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:12 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> so what kind of eviroment does a monkey group have to be seperated into in order for them to evolve complex emotions, speech, counscous, religous beliefs, and oppisable thumbs? is that in the desert or the jungle? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> because of crossing over. the DNA messes around a lil bit... I don't remember but I learned about it in biology. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Thus, the difference between species in Africa is enough so that we were the only ones to evolve "complex emotions, speech, counscous, religous beliefs, and oppisable thumbs[sic]." Maybe we were just the first ones and some other African species will evolve to have those things eventually.
<!--QuoteBegin-theclam+Mar 14 2005, 02:47 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 02:47 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 02:37 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 02:37 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> there's historical evidence that supports the bible. lemme find some real quick, I gotat pull my resources <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> When you find these sources, AvengerX, make a new thread. We can debate historical corroboration for religious books in another thread, so we can return to evolution here. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> I assume you're working on this. When you say you've got some sources, show them or shut up. If you don't do that, then don't expect people not to criticize you.
<!--QuoteBegin-AvengerX+Mar 14 2005, 03:20 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 03:20 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin- AvengerX+--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> ( AvengerX)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> Humans evolve. look at eskimoes.. they've evolved to be short and fat. and it works out for them... but if we leave eskimoes alone long enough, they won't turn into polar bears or gaint human penguins.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> That's because no modern animal is changing into any other modern animal, and nothing in evolution suggests that they should.
Avenger, I don't really know what more to offer you. Science has many many lines of evidence to offer demonstrating that common descent is a fact. We have fossils outlining the general transitions from fish to amphibious tetrapod to repitle to mammal-like reptile to mammals to primates to apes to humans (not ot mention lines for all sorts of other creatures beside ourselves). All of these exist in a geological sequence. Where did the early tetrapods go when they vanish out of the geologic record? Were did the reptiles come from when they appear in it?
The answer is that they evolved from each other, and the fossil evidence is the LEAST of the sorts of convincing evidence we have. The genetic record is even more clear that the modern animals we see can trace back their genetic heritage to various points of common ancestry. In fact, because of the relatively stable rates of mutations that accumulate in non-coding regions of the DNA, we can even get approximate dates of when the common ancestors of any two modern species lived. Surprisingly, the DNA dates match the fossil evidence with amazing consistency. How can you possibly explain this coincidence? And it doesn't stop there: these splits in lineage match up incredibly well with what we know of geographic isolation due to things like the continents separating. For instance, genetics and fossils both agree that creatures in India were originally separated from creatures in Africa at roughly the same time plate tectonics tells us India was pulling away from Africa. And when it crunches into Asia (raising the huge mountain ranges we know today), the speices on it spread out into Asia. Fossils, genetics, geography: all agree on things that could only be explained by common ancestry.
And that's just from the broad historical patterns. You can look at the fine detail of actual examples as well. Avenger looks at a range of hominid skulls and does what most creationists do: tries to claim that they are all either ape or human. But amausingly, most creationists can't even agree which are humand and which are apes: <a href='http://www.talkorigins.org/faqs/homs/compare.html' target='_blank'>http://www.talkorigins.org/faqs/homs/compare.html</a>
This is exactly what we'd expect if common descent were true! No one can agree which are human and which are ape because there IS no good, obvious dividing line. The two blend into each other just the way we would expect if they were the product of common descent and these fossils were random samplings of ongoing general directions in development.
And the fact is, claiming that early hominid skulls are all "humans" is a pretty darn weak argument. The fact is, these skulls have features which NO MODERN HUMAN HAS. That is, of course, why they are classed as separate species. But it's pretty obvious what has been happening here: these hominids came earlier, only later replaced by homo sapien sapien. That's evolution, that's common descent.
I'm not going to address the bible discussion, because as I said, that's not a subject that the mods wish to be mixed in a single thread. Move it to another thread, and I'll be happy to discuss it there.
Well, I skipped a lot of this thread (pages 4-12) in the effort to find something worth writing about. I have another linky - it talks about the age of the moon (not based on dust) - with the overriding assumption that the moon is (at most) 2.2 billion years old. It goes into a lot of math... found it quite intersting.
I don't care for his conclusions (not worded the best) - and I came up with my own. Lets assume that the moon did come from the earth - an offshoot of some comet or something (this is the popular theory of the day - right?) Can we not assume that such a catastrophy would kill most of the life on earth (at least all the bigger stuff). In turn, that limits evolution in time frame - giving a maximum of 2.2 billion years for things to settle down from the catastrophy, evolve from microbial state to dinosaurs... Basically, it cramps the time frame.
I guess I would be interested in hearing an evolutionists thoughts on this:
Pepe, it would be nice if you addressed past issues a little more before throwing in new elements.
Regardless, as for the moon and life, 2.2 billion years is far MORE than enough for the evolutionary timescale regardless, and indeed all the major evolutionary work happened in an even shorter timeframe. The sort of multicellular life that would be disrupted by comet strikes didn't even start appearing until around 600-500 million years ago anyway, and indeed it DOES appear to have been, at a few key times, nearly wiped out by major cosmic strikes. Indeed, all of this is a perfectly conventional part of the evolutionary timeline, as told to us via fossil evidence, geological evidence, and so forth.
Here's more on the moon, which unlike the article you linked to is written by actual scientists using the actual standard research and findings in the relevant fields. <a href='http://www.talkorigins.org/faqs/moonrec.html' target='_blank'>http://www.talkorigins.org/faqs/moonrec.html</a>
<!--QuoteBegin-Apos+Mar 14 2005, 12:22 AM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (Apos @ Mar 14 2005, 12:22 AM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> Of course, I'm not sure that Plato and Confucious really are all that similar in the end. <!--emo&:)--><img src='http://www.unknownworlds.com/forums/html/emoticons/smile-fix.gif' border='0' style='vertical-align:middle' alt='smile-fix.gif' /><!--endemo--> <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> Oh, of course they aren't. I simply find it intersting that a lot of different, yet similar cultural trends tend to crop up about the same time with strikingly similar elements between them. Confucius' ideas about a moral code actually have some striking similarites with the virtue-ethics of Aristotle's, just expounded upon hundreds of times until it's an almost Pharasaical doctrine.
<!--QuoteBegin-Apos+Mar 14 2005, 12:47 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (Apos @ Mar 14 2005, 12:47 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> Pepe, it would be nice if you addressed past issues a little more before throwing in new elements.
Regardless, as for the moon and life, 2.2 billion years is far MORE than enough for the evolutionary timescale regardless, and indeed all the major evolutionary work happened in an even shorter timeframe. The sort of multicellular life that would be disrupted by comet strikes didn't even start appearing until around 600-500 million years ago anyway, and indeed it DOES appear to have been, at a few key times, nearly wiped out by major cosmic strikes. Indeed, all of this is a perfectly conventional part of the evolutionary timeline, as told to us via fossil evidence, geological evidence, and so forth.
Here's more on the moon, which unlike the article you linked to is written by actual scientists using the actual standard research and findings in the relevant fields. <a href='http://www.talkorigins.org/faqs/moonrec.html' target='_blank'>http://www.talkorigins.org/faqs/moonrec.html</a> <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> Yeah, I'm sorry for not posting on one of the many open topics, but after trying to slog through 9 pages of dribble, I figured a decent question might be in order.
Second - your particular article, though interesting, is not any more "scientific" or any less bias than mine. Neither does it address the issue at hand - rather it points out that the original timeline might not be right (hinting that 1.4 billion years might be too short a timeline) - which is why I gave a generous 2.2 billion years.
The way I see it, evolutionists can't have it both ways. Let me explain. We know certain things about the earth and the moon - physics wise. We know its mass, its movements. We know its affects on tides. It is reasonable to assume that things work now the same way they have worked for all of time (a valid assumption evolutionists use to rectify carbon (and other isotope) dating techniques.
Given those assumptions, the maximum life of the earth / moon relationship is sitting at ~2.2 billion years - and it necessitates a catastrophic beginning. That is contrary to what <a href='http://www.palaeos.com/Hadean/Hadean.htm' target='_blank'>this site</a> claims - putting the creation of the moon out at the 4.5 billion year mark.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Second - your particular article, though interesting, is not any more "scientific" or any less bias than mine.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Bias? It is written by actual scientists, surveying the best of the work being done in the relevant fields and the commonly agreed upon research and evidence, rather than speculating wildly and near alleging conspiracy theories.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->The way I see it, evolutionists can't have it both ways. Let me explain. We know certain things about the earth and the moon - physics wise. We know its mass, its movements. We know its affects on tides. It is reasonable to assume that things work now the same way they have worked for all of time (a valid assumption evolutionists use to rectify carbon (and other isotope) dating techniques.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Nonsense. This is what the author of the article argues, but he gets the basic idea absurdly wrong. We do not assume that every single thing we currently see goes back in time unchanged at the same rate, and so on. We assume instead that the most basic LAWS and universal regularities we observe would stay the same. But those laws may suggest all sorts of different things happening to complex systems like the moon in the past in ways they do not happen now. The proof, as always, is found in the evidence. When we model things like the moon backwards in time, the _evidence_ tells us that things were not always quite the same, and the more complex models of the possible interactions between the two bodies tell us that the current recession we see is far from the only piece of the picture.
The moon is too complex of a system to model using almost kindergarden level mathematics, in contradiction to all the evidence and the knowledge that the interaction between the moon and the Earth is much more complicated than a simple single rate extened through time.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Given those assumptions, the maximum life of the earth / moon relationship is sitting at ~2.2 billion years - and it necessitates a catastrophic beginning. That is contrary to what this site claims - putting the creation of the moon out at the 4.5 billion year mark.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Again, first of all, all of this is completely academic in terms of life, because it wouldn't have made the evolution of higher lifeforms: a very recent occurance, any more or less unlikely.
Second of all the argument is wrong, as I have noted. There is no general principle that ALL observed processes should simply be extended backwards, in contradiction to actual evidence, models, an so on. It is the operation of natural laws based on things like quantum mechanics that we hold to be constant (in part because if they weren't, much of reality would decohere). As for processes, when we extend the process of natural selection backwards in time, we do so because we have no evidence that the basic conditions of life would have been different in ways that would have prevented it from operating: it still fits the model. Plus, we have actual positive evidence of the very characteristic operation of this mechanism in the past. So it's not in any sense a "you can't have it both ways" situation.
Regardless, you didn't have to pay attention to the tons of pages of Avenger/skulkbait argument to stay on track in discussing some of the issues you first raised.
Regardless of their credentials, the site you linked to does have bias - a specifically anti-creation one at that. To make the claim that they don't have bias because they are deemed "scientists" is naive thinking.
I understand that you are trying to force me into a corner where the only credible sources I have are ones that you deem credible - which are the ones that support your argument. That is simply not the case - both of our arguments have credible researchers - and both arguments have bias, and agendas, presuppositions, etc. etc. To claim otherwise defeats the purpose of this discussion.
Now that we are done discrediting each other, lets get to the science.
So yes, the moon / earth relationship is complex - but I haven't seen any compelling reason to assume that the forces that govern this relationship have changed so as to extend their relationship past the 2.2 billion year mark.
So far what I have seen is "scientists" claiming that it doesn't fit their model, so the relationship must be too complex and somehow the moon has managed to stay out there 1/2 a lifetime longer than it is able to (over 3.5 billion years).
It doesn't matter that much anyway - im arguing 2.2 billion v 4.5 billion. Being that I beleive that the moon was placed there by God (for evidence, why does the same face of the moon always face earth? an astronomical coincidence - why is our planet the only one that has a moon proportionatly that large to it - which is just large enough to affect the tides to a reaonable level? an astronomical coincidence! - ahh yes, we need tides for tide pools for abogenisis - it all makes sence now <!--emo&:)--><img src='http://www.unknownworlds.com/forums/html/emoticons/smile-fix.gif' border='0' style='vertical-align:middle' alt='smile-fix.gif' /><!--endemo-->
<!--QuoteBegin-Pepe Muffassa+Mar 14 2005, 04:30 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (Pepe Muffassa @ Mar 14 2005, 04:30 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> Being that I beleive that the moon was placed there by God (for evidence, why does the same face of the moon always face earth? an astronomical coincidence - why is our planet the only one that has a moon proportionatly that large to it - which is just large enough to affect the tides to a reaonable level? an astronomical coincidence! - ahh yes, we need tides for tide pools for abogenisis - it all makes sence now <!--emo&:)--><img src='http://www.unknownworlds.com/forums/html/emoticons/smile-fix.gif' border='0' style='vertical-align:middle' alt='smile-fix.gif' /><!--endemo--> <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> We need tide pools for abiogenesis? I've never heard that before. Mars seems to have microorganisms but it doesn't have a large moon.
the point that just because someone is a scientist doesn't make them unbais. I mean Scientistists have been tools of politics for ages now. and they will allways have their little agendas.
<!--QuoteBegin-AvengerX+Mar 14 2005, 04:50 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 04:50 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> the point that just because someone is a scientist doesn't make them unbais. I mean Scientistists have been tools of politics for ages now. and they will allways have their little agendas. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> You're right. Individual scientists are biased. However, every serious scientific theory goes through a huge amount of peer review. That remove any bias from a theory. Scientists are biased. Science isn't biased.
<!--QuoteBegin-theclam+Mar 14 2005, 04:57 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (theclam @ Mar 14 2005, 04:57 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> <!--QuoteBegin-AvengerX+Mar 14 2005, 04:50 PM--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> (AvengerX @ Mar 14 2005, 04:50 PM)</td></tr><tr><td id='QUOTE'><!--QuoteEBegin--> the point that just because someone is a scientist doesn't make them unbais. I mean Scientistists have been tools of politics for ages now. and they will allways have their little agendas. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd--> You're right. Individual scientists are biased. However, every serious scientific theory goes through a huge amount of peer review. They remove any bias from a theory. Scientists are biased. Science isn't biased. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd--> science is baised agaisnt faith.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Regardless of their credentials, the site you linked to does have bias - a specifically anti-creation one at that. To make the claim that they don't have bias because they are deemed "scientists" is naive thinking.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Individual scientists indeed have biases. But science as a social institution is remarkably effective at weeding out bias, because it is a highly comptetative and hotly argumentative enterprise.
However, if people become frustrated with and hostile towards creationists, it should be no wonder. Even you should admit that creationists have a long long history of peddling extremely dishonest lies to the public, and in doing so slandering the careers and motives of countless dedicated and sincere scientists. They have an open and systematic agenda that scientists just generally do not. Scientists are interested in discovering the truth. It was creationists that burst onto the scene with a big agenda, not liking where the truth was heading.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->I understand that you are trying to force me into a corner where the only credible sources I have are ones that you deem credible - which are the ones that support your argument. That is simply not the case - both of our arguments have credible researchers - and both arguments have bias, and agendas, presuppositions, etc. etc. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
And I understand that you are trying to establish things so that you can match the in-depth research of thousands of respected scientists, skilled experts in their fields, with the ravings of some guy you found by googling. That's just not a fair comparison. When I say credible, I mean research and ideas that are extremely well-established and accepted by a wide range of experts from acredited universities and robust peer-review. Those are all processes that help weed out bad ideas. That you want to just toss all that out and make everyone's arguments, no matter what the evidence or the support is, equal, is ridiculous.
I'm sorry, but mainstream astrophysics and astronomy just aren't "just as good" as some yahoo with a website and a grudge.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->So yes, the moon / earth relationship is complex - but I haven't seen any compelling reason to assume that the forces that govern this relationship have changed so as to extend their relationship past the 2.2 billion year mark.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Did you read the link I gave you? Have you actually talked to any ACTUAL astrophysicists who actually study these sorts of things for a living, spending years considering the data, publishing papers, revising their findings, and so on, as opposed to just you by yourself sitting down and trying to figure it out yourself in a couple of minutes?
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->(for evidence, why does the same face of the moon always face earth?<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
What in the heck does this have to do with anything? The moon didn't always have only one side that faces the earth: it has become this way due to the dynamics of gravity via a phenomenon known as locking.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->why is our planet the only one that has a moon proportionatly that large to it - which is just large enough to affect the tides to a reaonable level? an astronomical coincidence!<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
What is a "reasonable" level? Life generally adapts to the conditions it finds, not the other way around. But then, if there was some condition necessary to life, this still isn't a very good argument, because there are no doubt an inumerable amount of planets in the universe with all sorts of different sizes of moons.
Comments
Here is the page I got that from:
<a href='http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Taxonomy.html' target='_blank'>http://users.rcn.com/jkimball.ma.ultranet/...T/Taxonomy.html</a>
I'd love to debate homologous structures and similarities between hox genes and hemoglobins, but my understanding of them isn't great enough to explain them very well.
Here's wikipedia on Hox genes:
<a href='http://en.wikipedia.org/wiki/Hox_gene_family' target='_blank'>http://en.wikipedia.org/wiki/Hox_gene_family</a>
Hox genes are found in all animals, from flies to humans. Hox genes are used to determine which side is up and which side is forward. Animals like humans use the hox genes to make sure that we develop in the correct directions. Insects use the hox genes to create their segments. Starfish only have one set of hox genes, for top and bottom, but not for front and back, which is why they exhibit radial symmetry.
Here's some more on this sort of thing:
<a href='http://en.wikipedia.org/wiki/Molecular_clock' target='_blank'>http://en.wikipedia.org/wiki/Molecular_clock</a>
Here's a choice quote:
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->the quantity of amino acid differences in hemoglobin between lineages roughly matched the known evolutionary rate of divergence based upon fossil evidence<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
DNA evidence shows that some parts of DNA are almost exactly the same in all forms of life, from bacteria to humans. That's why they can splice genes from some animals into other animals (and the basis for some genetic engineering in GM crops). Other parts of DNA are similiar but different roughly based upon how closely related two forms of life are. Our hemoglobin DNA segments are very close to chimpanzees and gibbons, somewhat close to mice, and pretty far away from flies.
Now, do you have any objections to this, or do you accept that macroevolution is true?
You're right. Monkeys have baby monkeys.
However, what happens if two groups of the same species of monkey are split apart? Say, because of the separation of continents due to tectonic plates shifting. They'll be in different environments. If one environment is wet and the other is dry, then the monkeys that use their water more efficiently will thrive in the drier environment, while the monkeys that can take advantage of the increased water will thrive in the wetter environment. Eventually, they won't be able to breed together and macroevolution has occured.
Here's a real life example:
<a href='http://www.santarosa.edu/lifesciences/ensatina.htm' target='_blank'>http://www.santarosa.edu/lifesciences/ensatina.htm</a>
Salamanders exist in california in a gradient. There is species A that is right next to species B that is right next to species C that is right next to species D and so on. Species A can interbreed with species B and C, but not with species D. Species B and interbreed with A and C and D, but not with E. Etc. Even though the salamanders are connected by land in a continuous path, they still have formed many different species. Strong salamanders group up and have baby salamanders that are slightly different, just enough so that new species can form.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->how come if there's millions of fossils that show missing links there's no living animals that show missing links? I mean why isn't their any monkey/human hybrids running around anymore?<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Evolution doesn't expect human/monkey hybrids. Think of it like this: You've got a 3rd cousin. You share great great grandparents with this cousin. If you are both descended from the same person, why isn't there a hybrid between you and your cousin? Why isn't there a hybrid with your eyes, her ears, your hair color, etc?
Because they either evolved into us, or died out (neanderthals, cro magnus, which both lived during the existance of homo sapiens, but eventually died out).
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->theres only four acids that make up DNA. so its really no wonder everything is somewhat close.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
That doesn't really make sense. I mean, in a computer, there are only two states for a bit: 1 and 0. Yet if you look at all the different things that come from a computer, they can be very, very different.
Because they either evolved into us, or died out (neanderthals, cro magnus, which both lived during the existance of homo sapiens, but eventually died out).
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->theres only four acids that make up DNA. so its really no wonder everything is somewhat close.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
That doesn't really make sense. I mean, in a computer, there are only two states for a bit: 1 and 0. Yet if you look at all the different things that come from a computer, they can be very, very different. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
but computer programs don't all come from the same computer program. they didn't evovlve from one omni program did they.
I don't think you understand. Here are two sample DNA sequences that I made up out of thin air:
<!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1-->
AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA
AAAGCCCCCCCCAAAATTGGCATTGGCATGCTCGA
<!--c2--></td></tr></table><div class='postcolor'><!--ec2-->
<!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1-->
AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA
AAAGCCCCCCCCAAAATTCGCATTGGCATGCTCGA
<!--c2--></td></tr></table><div class='postcolor'><!--ec2-->
Don't spot the difference? Check after the TT in the second line.
The difference between these two sequences is greater than the difference between human and chimpanzee DNA. Even though there are only 4 acids, if the acids were chosen randomly, there would be about a 1 in 4000000000000000000000000000000000000000000000000000000000000 chance that the 2 DNA sequences would show the same amount of difference as human and chimpanzee DNA. That's only for 100 base pairs. If you did 100 base pairs, it would be exponentially higher than that.
The environment would be something like sub-Saharan Africa.
I don't think you understand. Here are two sample DNA sequences that I made up out of thin air:
<!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1-->
AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA
AAAGCCCCCCCCAAAATTGGCATTGGCATGCTCGA
<!--c2--></td></tr></table><div class='postcolor'><!--ec2-->
<!--c1--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>CODE</b> </td></tr><tr><td id='CODE'><!--ec1-->
AGCTAGAATTTCAGATTCAAGGGTCCCTAAAGATTA
AAAGCCCCCCCCAAAATTCGCATTGGCATGCTCGA
<!--c2--></td></tr></table><div class='postcolor'><!--ec2-->
Don't spot the difference? Check after the TT in the second line.
The difference between these two sequences is greater than the difference between human and chimpanzee DNA. Even though there are only 4 acids, if the acids were chosen randomly, there would be about a 1 in 4000000000000000000000000000000000000000000000000000000000000 chance that the 2 DNA sequences would show the same amount of difference as human and chimpanzee DNA. That's only for 100 base pairs. If you did 100 base pairs, it would be exponentially higher than that. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
so what your saying. is that god used a lot of the same code when he made man as when he made monkeys right?
The environment would be something like sub-Saharan Africa. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others?
then he should have written it in the scriptures.
Humans evolve. look at eskimoes.. they've evolved to be short and fat. and it works out for them... but if we leave eskimoes alone long enough, they won't turn into polar bears or gaint human penguins.
The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you.
The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
because of crossing over. the DNA messes around a lil bit... I don't remember but I learned about it in biology.
then he should have written it in the scriptures. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
Do you actually think that God explicitly tells you everything that he wants you to know? Are you presuming that scriptures tell you every single thing that he wants you to know? That's like a teacher handing you a stack of books and telling you that the stack contains every single thing that you will learn in school and that experience and self-exploration (or scientific exploration in the case of evolution) aren't part of that?
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Humans evolve. look at eskimoes.. they've evolved to be short and fat. and it works out for them... but if we leave eskimoes alone long enough, they won't turn into polar bears or gaint human penguins.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
So? That's a strawman, no one is claiming that they would.
The environment would be something like sub-Saharan Africa. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
lots of things live in Africa, so why are none of them like humans? I mean theres tons of varieties of all the other animal families... so why not humans? or did some humans come from other animals then others? <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Why aren't you exactly like your siblings? You share 50% of your DNA and you grew up in the exact same environment.
All humans came from one direct ancestor. All chimpanzees came from one direct ancestor. All Humans and chimpanzees came from one direct ancestor. The chance that two species could evolve from different ancestors and become a single species is even more unlikely than the example I gave you. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
because of crossing over. the DNA messes around a lil bit... I don't remember but I learned about it in biology. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
Thus, the difference between species in Africa is enough so that we were the only ones to evolve "complex emotions, speech, counscous, religous beliefs, and oppisable thumbs[sic]." Maybe we were just the first ones and some other African species will evolve to have those things eventually.
there's historical evidence that supports the bible. lemme find some real quick, I gotat pull my resources <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
When you find these sources, AvengerX, make a new thread. We can debate historical corroboration for religious books in another thread, so we can return to evolution here. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
I assume you're working on this. When you say you've got some sources, show them or shut up. If you don't do that, then don't expect people not to criticize you.
That's because no modern animal is changing into any other modern animal, and nothing in evolution suggests that they should.
Avenger, I don't really know what more to offer you. Science has many many lines of evidence to offer demonstrating that common descent is a fact. We have fossils outlining the general transitions from fish to amphibious tetrapod to repitle to mammal-like reptile to mammals to primates to apes to humans (not ot mention lines for all sorts of other creatures beside ourselves). All of these exist in a geological sequence. Where did the early tetrapods go when they vanish out of the geologic record? Were did the reptiles come from when they appear in it?
The answer is that they evolved from each other, and the fossil evidence is the LEAST of the sorts of convincing evidence we have. The genetic record is even more clear that the modern animals we see can trace back their genetic heritage to various points of common ancestry. In fact, because of the relatively stable rates of mutations that accumulate in non-coding regions of the DNA, we can even get approximate dates of when the common ancestors of any two modern species lived. Surprisingly, the DNA dates match the fossil evidence with amazing consistency. How can you possibly explain this coincidence? And it doesn't stop there: these splits in lineage match up incredibly well with what we know of geographic isolation due to things like the continents separating. For instance, genetics and fossils both agree that creatures in India were originally separated from creatures in Africa at roughly the same time plate tectonics tells us India was pulling away from Africa. And when it crunches into Asia (raising the huge mountain ranges we know today), the speices on it spread out into Asia. Fossils, genetics, geography: all agree on things that could only be explained by common ancestry.
And that's just from the broad historical patterns. You can look at the fine detail of actual examples as well. Avenger looks at a range of hominid skulls and does what most creationists do: tries to claim that they are all either ape or human. But amausingly, most creationists can't even agree which are humand and which are apes:
<a href='http://www.talkorigins.org/faqs/homs/compare.html' target='_blank'>http://www.talkorigins.org/faqs/homs/compare.html</a>
This is exactly what we'd expect if common descent were true! No one can agree which are human and which are ape because there IS no good, obvious dividing line. The two blend into each other just the way we would expect if they were the product of common descent and these fossils were random samplings of ongoing general directions in development.
And the fact is, claiming that early hominid skulls are all "humans" is a pretty darn weak argument. The fact is, these skulls have features which NO MODERN HUMAN HAS. That is, of course, why they are classed as separate species. But it's pretty obvious what has been happening here: these hominids came earlier, only later replaced by homo sapien sapien. That's evolution, that's common descent.
I'm not going to address the bible discussion, because as I said, that's not a subject that the mods wish to be mixed in a single thread. Move it to another thread, and I'll be happy to discuss it there.
I don't care for his conclusions (not worded the best) - and I came up with my own. Lets assume that the moon did come from the earth - an offshoot of some comet or something (this is the popular theory of the day - right?) Can we not assume that such a catastrophy would kill most of the life on earth (at least all the bigger stuff). In turn, that limits evolution in time frame - giving a maximum of 2.2 billion years for things to settle down from the catastrophy, evolve from microbial state to dinosaurs... Basically, it cramps the time frame.
I guess I would be interested in hearing an evolutionists thoughts on this:
<a href='http://www.ridgenet.net/~do_while/sage/v2i2f.htm' target='_blank'>Linky</a>
Regardless, as for the moon and life, 2.2 billion years is far MORE than enough for the evolutionary timescale regardless, and indeed all the major evolutionary work happened in an even shorter timeframe. The sort of multicellular life that would be disrupted by comet strikes didn't even start appearing until around 600-500 million years ago anyway, and indeed it DOES appear to have been, at a few key times, nearly wiped out by major cosmic strikes. Indeed, all of this is a perfectly conventional part of the evolutionary timeline, as told to us via fossil evidence, geological evidence, and so forth.
Here's more on the moon, which unlike the article you linked to is written by actual scientists using the actual standard research and findings in the relevant fields.
<a href='http://www.talkorigins.org/faqs/moonrec.html' target='_blank'>http://www.talkorigins.org/faqs/moonrec.html</a>
Oh, of course they aren't. I simply find it intersting that a lot of different, yet similar cultural trends tend to crop up about the same time with strikingly similar elements between them. Confucius' ideas about a moral code actually have some striking similarites with the virtue-ethics of Aristotle's, just expounded upon hundreds of times until it's an almost Pharasaical doctrine.
Regardless, as for the moon and life, 2.2 billion years is far MORE than enough for the evolutionary timescale regardless, and indeed all the major evolutionary work happened in an even shorter timeframe. The sort of multicellular life that would be disrupted by comet strikes didn't even start appearing until around 600-500 million years ago anyway, and indeed it DOES appear to have been, at a few key times, nearly wiped out by major cosmic strikes. Indeed, all of this is a perfectly conventional part of the evolutionary timeline, as told to us via fossil evidence, geological evidence, and so forth.
Here's more on the moon, which unlike the article you linked to is written by actual scientists using the actual standard research and findings in the relevant fields.
<a href='http://www.talkorigins.org/faqs/moonrec.html' target='_blank'>http://www.talkorigins.org/faqs/moonrec.html</a> <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
Yeah, I'm sorry for not posting on one of the many open topics, but after trying to slog through 9 pages of dribble, I figured a decent question might be in order.
Second - your particular article, though interesting, is not any more "scientific" or any less bias than mine. Neither does it address the issue at hand - rather it points out that the original timeline might not be right (hinting that 1.4 billion years might be too short a timeline) - which is why I gave a generous 2.2 billion years.
The way I see it, evolutionists can't have it both ways. Let me explain. We know certain things about the earth and the moon - physics wise. We know its mass, its movements. We know its affects on tides. It is reasonable to assume that things work now the same way they have worked for all of time (a valid assumption evolutionists use to rectify carbon (and other isotope) dating techniques.
Given those assumptions, the maximum life of the earth / moon relationship is sitting at ~2.2 billion years - and it necessitates a catastrophic beginning. That is contrary to what <a href='http://www.palaeos.com/Hadean/Hadean.htm' target='_blank'>this site</a> claims - putting the creation of the moon out at the 4.5 billion year mark.
Bias? It is written by actual scientists, surveying the best of the work being done in the relevant fields and the commonly agreed upon research and evidence, rather than speculating wildly and near alleging conspiracy theories.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->The way I see it, evolutionists can't have it both ways. Let me explain. We know certain things about the earth and the moon - physics wise. We know its mass, its movements. We know its affects on tides. It is reasonable to assume that things work now the same way they have worked for all of time (a valid assumption evolutionists use to rectify carbon (and other isotope) dating techniques.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Nonsense. This is what the author of the article argues, but he gets the basic idea absurdly wrong. We do not assume that every single thing we currently see goes back in time unchanged at the same rate, and so on. We assume instead that the most basic LAWS and universal regularities we observe would stay the same. But those laws may suggest all sorts of different things happening to complex systems like the moon in the past in ways they do not happen now. The proof, as always, is found in the evidence. When we model things like the moon backwards in time, the _evidence_ tells us that things were not always quite the same, and the more complex models of the possible interactions between the two bodies tell us that the current recession we see is far from the only piece of the picture.
The moon is too complex of a system to model using almost kindergarden level mathematics, in contradiction to all the evidence and the knowledge that the interaction between the moon and the Earth is much more complicated than a simple single rate extened through time.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->Given those assumptions, the maximum life of the earth / moon relationship is sitting at ~2.2 billion years - and it necessitates a catastrophic beginning. That is contrary to what this site claims - putting the creation of the moon out at the 4.5 billion year mark.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Again, first of all, all of this is completely academic in terms of life, because it wouldn't have made the evolution of higher lifeforms: a very recent occurance, any more or less unlikely.
Second of all the argument is wrong, as I have noted. There is no general principle that ALL observed processes should simply be extended backwards, in contradiction to actual evidence, models, an so on. It is the operation of natural laws based on things like quantum mechanics that we hold to be constant (in part because if they weren't, much of reality would decohere). As for processes, when we extend the process of natural selection backwards in time, we do so because we have no evidence that the basic conditions of life would have been different in ways that would have prevented it from operating: it still fits the model. Plus, we have actual positive evidence of the very characteristic operation of this mechanism in the past. So it's not in any sense a "you can't have it both ways" situation.
Regardless, you didn't have to pay attention to the tons of pages of Avenger/skulkbait argument to stay on track in discussing some of the issues you first raised.
I understand that you are trying to force me into a corner where the only credible sources I have are ones that you deem credible - which are the ones that support your argument. That is simply not the case - both of our arguments have credible researchers - and both arguments have bias, and agendas, presuppositions, etc. etc. To claim otherwise defeats the purpose of this discussion.
Now that we are done discrediting each other, lets get to the science.
So yes, the moon / earth relationship is complex - but I haven't seen any compelling reason to assume that the forces that govern this relationship have changed so as to extend their relationship past the 2.2 billion year mark.
So far what I have seen is "scientists" claiming that it doesn't fit their model, so the relationship must be too complex and somehow the moon has managed to stay out there 1/2 a lifetime longer than it is able to (over 3.5 billion years).
It doesn't matter that much anyway - im arguing 2.2 billion v 4.5 billion. Being that I beleive that the moon was placed there by God (for evidence, why does the same face of the moon always face earth? an astronomical coincidence - why is our planet the only one that has a moon proportionatly that large to it - which is just large enough to affect the tides to a reaonable level? an astronomical coincidence! - ahh yes, we need tides for tide pools for abogenisis - it all makes sence now <!--emo&:)--><img src='http://www.unknownworlds.com/forums/html/emoticons/smile-fix.gif' border='0' style='vertical-align:middle' alt='smile-fix.gif' /><!--endemo-->
We need tide pools for abiogenesis? I've never heard that before. Mars seems to have microorganisms but it doesn't have a large moon.
You're right. Individual scientists are biased. However, every serious scientific theory goes through a huge amount of peer review. That remove any bias from a theory. Scientists are biased. Science isn't biased.
You're right. Individual scientists are biased. However, every serious scientific theory goes through a huge amount of peer review. They remove any bias from a theory. Scientists are biased. Science isn't biased. <!--QuoteEnd--> </td></tr></table><div class='postcolor'> <!--QuoteEEnd-->
science is baised agaisnt faith.
Individual scientists indeed have biases. But science as a social institution is remarkably effective at weeding out bias, because it is a highly comptetative and hotly argumentative enterprise.
However, if people become frustrated with and hostile towards creationists, it should be no wonder. Even you should admit that creationists have a long long history of peddling extremely dishonest lies to the public, and in doing so slandering the careers and motives of countless dedicated and sincere scientists. They have an open and systematic agenda that scientists just generally do not. Scientists are interested in discovering the truth. It was creationists that burst onto the scene with a big agenda, not liking where the truth was heading.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->I understand that you are trying to force me into a corner where the only credible sources I have are ones that you deem credible - which are the ones that support your argument. That is simply not the case - both of our arguments have credible researchers - and both arguments have bias, and agendas, presuppositions, etc. etc. <!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
And I understand that you are trying to establish things so that you can match the in-depth research of thousands of respected scientists, skilled experts in their fields, with the ravings of some guy you found by googling. That's just not a fair comparison. When I say credible, I mean research and ideas that are extremely well-established and accepted by a wide range of experts from acredited universities and robust peer-review. Those are all processes that help weed out bad ideas. That you want to just toss all that out and make everyone's arguments, no matter what the evidence or the support is, equal, is ridiculous.
I'm sorry, but mainstream astrophysics and astronomy just aren't "just as good" as some yahoo with a website and a grudge.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->So yes, the moon / earth relationship is complex - but I haven't seen any compelling reason to assume that the forces that govern this relationship have changed so as to extend their relationship past the 2.2 billion year mark.<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
Did you read the link I gave you? Have you actually talked to any ACTUAL astrophysicists who actually study these sorts of things for a living, spending years considering the data, publishing papers, revising their findings, and so on, as opposed to just you by yourself sitting down and trying to figure it out yourself in a couple of minutes?
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->(for evidence, why does the same face of the moon always face earth?<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
What in the heck does this have to do with anything? The moon didn't always have only one side that faces the earth: it has become this way due to the dynamics of gravity via a phenomenon known as locking.
<!--QuoteBegin--></div><table border='0' align='center' width='95%' cellpadding='3' cellspacing='1'><tr><td><b>QUOTE</b> </td></tr><tr><td id='QUOTE'><!--QuoteEBegin-->why is our planet the only one that has a moon proportionatly that large to it - which is just large enough to affect the tides to a reaonable level? an astronomical coincidence!<!--QuoteEnd--></td></tr></table><div class='postcolor'><!--QuoteEEnd-->
What is a "reasonable" level? Life generally adapts to the conditions it finds, not the other way around. But then, if there was some condition necessary to life, this still isn't a very good argument, because there are no doubt an inumerable amount of planets in the universe with all sorts of different sizes of moons.